химический каталог




Молекулярная биология. Структура рибосомы и биосинтез белка

Автор А.С.Спирин

ло, частично) полипуриновой прединициирующей последовательности мРНК. Некоторые примеры даны на рис. 115. Считается, что комплементарное спаривание З'-концевого участка 16S РНК с прединициирующим полипуриновым блоком мРНК прямо участвует в ассоциации свободной рибосомной 30S субчастицы с матричным полинуклеотидом.

Необходимо отметить, однако, что инициация трансляции свободными рибосомами в какой-то мере возможна, по-видимому, также и на матрицах без последовательности Шайна — Дальгарно. Так, мРНК репрессора cl фага X, транскрибируемая с промотора A.pRM (в лизогенной клетке), вообще не имеет прединициирующей последовательности, но инициация на ней происходит, хотя и не очень эффективно. Бактериальные рибосомы могут осуществлять также инициацию на некоторых чужеродных (эукариотических) РНК, лишенных последовательности Шайна —Дальгарно, например, на РНК 4 вируса мозаики костра; инициация требует всех трех бактериальных факторов инициации и происходит на нормальном инициирующем кодоне. Отсюда последовательность Шайна — Дальгарно, безусловно, вносит важный вклад в эффективную ассоциацию рибосомных частиц с матрицей, но не является абсолютным требованием.

Если рибосома читает полициетронную мРНК и после термина-ции предыдущего цистрона не соскакивает с матрицы, то для новой инициации на следующем цистроне она, по-видимому, не требует последовательности Шайна —Дальгарно.

5. ПОСЛЕДОВАТЕЛЬНОСТЬ СОБЫТИЙ В ПРОЦЕССЕ ИНИЦИАЦИИ

Итак, во всех случаях инициации трансляции предшествует диссоциация нетранслирующих 70S рибосом на 30S и 50S субчастицы. Как уже говорилось, в физиологических условиях нетранслирующие рибосомы находятся в обратимом равновесии со своими субчастицами. IF-3 имеет довольно сильное сродство именно к диссоциированной 30S субчастице и, связываясь с ней, препятствует ее реассоциации с 50S субчастицей; таким образом, 30S субчастица уводится из равновесия и подготавливается для инициации:

70S ' 30S + 5OS

+ IF-3 f

I I I

' 'I

30S • IF-3

Два других фактора инициации, IF-1 и IF-2, также имеют большее или меньшее сродство к 30S субчастице и могут связываться с ней:

30S • IF-3 + IF-1 + IF-2 < 30S • IF-3 • IF-2 • IF-1

MS2 А белок: 5'... UCCUAGGAG6UUUGACCUGUGCGAGCUUUU... 3

^UCCUCCAC^

MS2 бепок оболочки: 5'... UCAACCGGAGUUUGAAGCAUGGCUUCCAАС 3

^оссисс4«

МЭгсинтетаза: 5'... СА-ААС AUGAGG AUU АССС AU GUCGAAG АС А... 3

0CCUCC^C

? %

T4r|JB: 5'... CCUAAUAAGGAAAAUUAJJGUACAAU ...

„АииССиСл

* %

р- галактозидаза 51... UUC ACAC AGG A A ACAGCUAUGACC AUG AU Ц. {lac Z):

. OUCCUCcРНК полимеразо AGCGAGCUGAGGAACCCUAUGGUUUACUCC...

6- субъединица: vcCUCC4C,

Рибосомный б!.. AAAACCAGGAGCUAUUUAAUGGCAACAGUU...

бепок S12: ^UCCUCcr,

jo О.

* Ъ

Рибосомный б!.. CAUCCAGGAGCAAAGCUAAUGGCUUUAAAU...

белок L10: ^UCCUCC^ .

РИС. 115. Нуклеотидные последовательности, предшествующие ини-циаторному кодону (AUG или GUG), для ряда мРНК, кодирующих фаговые и бактериальные белки, и схема спаривания их полипури-новых блоков (последовательности Шайна — Дальгарно) с 3'-концевым полипиримидиновым блоком рибосомной 16S РНК

Далее, 30S субчастица с IF-3 или со всеми факторами инициации может ассоциировать с инициаторным районом мРНК. Этот район может находиться близко у 5'-конца или далеко от него, а в случае полицистронных мРНК таких районов может быть несколько вдоль всей цепи мРНК; важно лишь то, чтобы он был открыт для взаимодействия, имел подходящую конформацию и содержал прединициирующую полипуриновую последовательность Шайна — Дальгарно и инициирующий триплет AUG (или GUG, или UUG, и т. д.). Сама 30S субчастица, без факторов инициации, также способна узнавать инициирующий район мРНК и связываться с ним. Вместе с тем, IF-3, по-видимому, способствует ассоциации 30S субчастицы с мРНК, возможно, путем усиления комплементарного взаимодействия З'-конца рибосомной РНК с последовательностью Шайна — Дальгарно или путем привнесения дополнительного взаимодействия между рибосомной частицей и матрицей.

На следующей стадии вступает в действие IF-2, либо уже ассоциированный с 30S субчастицей, либо находящейся в растворе. Он взаимодействует с ГТФ и с инициаторной F-Met-tRNAF, в результате чего имеет место кооперативное образование инициатор-ного ЗОБ-комплекса с освобождением IF-3:

30S • mRNA • IF-3 + IF-2 + GTP + F-Met-tRNAF <

< 30S • mRNA • F-Met-tRNAp • IF-2 • GTP + IF-3

Здесь, как и в случае факторов элонгации, ГТФ выступает в роли эффектора, придающего фактору IF-2 повышенное сродство к рибосоме (в данном случае к 30S субчастице) и к соответствующей тРНК (F-Met-tRNAF). По-видимому, сначала ГТФ взаимодействует с IF-2, а затем комплекс IF-2 • GTP связывает F-Met-tRNA; F-Met-tRNA узнает инициирующий кодон на 30S субчастице, a IF-2 • GTP обеспечивает дополнительное взаимодействие, комплексируясь одновременно с F-Met-tRNA и с рибосомной частицей. В процессе образования этого инициаторного ЗОБ-комплекса ГТФ не расщепляется и, как уже отмечалось, может быть с полным успехом заме

страница 97
< К СПИСКУ КНИГ > 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136

Скачать книгу "Молекулярная биология. Структура рибосомы и биосинтез белка" (3.76Mb)


[каталог]  [статьи]  [доска объявлений]  [прайс-листы]  [форум]  [обратная связь]

 

 

Реклама
курсы массажа в москве дешево
курсы кассиров москва
Lorus RT311CX9
tokio hotel в москве 2016

Рекомендуемые книги

Введение в химию окружающей среды.

Книга известных английских ученых раскрывает основные принципы химии окружающей среды и их действие в локальных и глобальных масштабах. Важный аспект книги заключается в раскрытии механизма действия природных геохимических процессов в разных масштабах времени и влияния на них человеческой деятельности. Показываются химический состав, происхождение и эволюция земной коры, океанов и атмосферы. Детально рассматриваются процессы выветривания и их влияние на химический состав осадочных образований, почв и поверхностных вод на континентах. Для студентов и преподавателей факультетов биологии, географии и химии университетов и преподавателей средних школ, а также для широкого круга читателей.

Химия и технология редких и рассеянных элементов.

Книга представляет собой учебное пособие по специальным курсам для студентов химико-технологических вузов. В первой части изложены основы химии и технологии лития, рубидия, цезия, бериллия, галлия, индия, таллия. Во второй части книги изложены основы химии и технологии скандия, натрия, лантана, лантаноидов, германия, титана, циркония, гафния. В третьей части книги изложены основы химии и технологии ванадия, ниобия, тантала, селена, теллура, молибдена, вольфрама, рения. Наибольшее внимание уделено свойствам соединений элементов, имеющих значение в технологии. В технологии каждого элемента описаны важнейшие области применения, характеристика рудного сырья и его обогащение, получение соединений из концентратов и отходов производства, современные методы разделения и очистки элементов. Пособие составлено по материалам, опубликованным из советской и зарубежной печати по 1972 год включительно.

 

 



Рейтинг@Mail.ru Rambler's Top100

Copyright © 2001-2012
(09.12.2016)